View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9459_high_18 (Length: 214)

Name: NF9459_high_18
Description: NF9459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9459_high_18
NF9459_high_18
[»] chr4 (1 HSPs)
chr4 (19-199)||(38021622-38021802)


Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 38021622 - 38021802
Alignment:
19 aggttaattgaataagaaaaagtgattattgtgaattagtacctcccagtaggagacaccttggcggtaccagagggttttcttgttagggtcgccggct 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
38021622 aggttaattgaataagaaaaagtgattattgtgaattagtacctcccagtaggagacaccttggcggtaccagagggttttcttgttagggtcgccggtt 38021721  T
119 tgttctttccacatctcgttggcggttttgtactcgcggccattggaatctgagccgccggcatccatgaaggctgttgtt 199  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
38021722 tgttctttccacatctcgtcggcggttttgtactcgcggccattggaatctgagccgccggcgtccatgaaggctgttgtt 38021802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University