View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9459_low_22 (Length: 265)
Name: NF9459_low_22
Description: NF9459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9459_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 251
Target Start/End: Original strand, 31734196 - 31734430
Alignment:
| Q |
12 |
gttgaagctaactatactagactagagtgacagaaggaagaaacttttgttatagaatttttagcatagaaatgcttgcctcggactttatctctatgga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31734196 |
gttgaagctaactatactagactagagtgacagaaggaagaaacttttgttatagaatttttagcatagaaatgcttgcctcggactttatctctatgga |
31734295 |
T |
 |
| Q |
112 |
gattggaccaaaactaagtgatatcgtctagaaattaaaattacctgacttcgagagtcatgatgatattactggcgaatgtcttgatcagaatgtggtt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31734296 |
gattggaccaaaactaagtgatatcgtctag-----aaaattacctgacttcgagagtcatgatgatattactggcaaatgtcttgatcagaatgtggtt |
31734390 |
T |
 |
| Q |
212 |
tacttcagaaatgatatgtcgactgtatctatgaagcatg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31734391 |
tacttcagaaatgatatgtcgactgtatctatgaagcatg |
31734430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 32 - 83
Target Start/End: Original strand, 31746751 - 31746802
Alignment:
| Q |
32 |
actagagtgacagaaggaagaaacttttgttatagaatttttagcatagaaa |
83 |
Q |
| |
|
||||||||| || || ||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
31746751 |
actagagtggcaaaaagaagaaacttttgttgtagattttttagcatagaaa |
31746802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 13218525 - 13218573
Alignment:
| Q |
157 |
tgacttcgagagtcatgatgatattactggcgaatgtcttgatcagaat |
205 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
13218525 |
tgacttcgaaagtcatgatgatattactgaggaacgtctttatcagaat |
13218573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University