View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9459_low_25 (Length: 256)
Name: NF9459_low_25
Description: NF9459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9459_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 38533108 - 38533347
Alignment:
| Q |
1 |
ccgcaaggaacctatgtgttcaccttctaaagcttttctacgtggaaacaaagcatgcaagcttgcgcttgagaatttacccgatgaggtttacgatacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38533108 |
ccgcaaggaacctatgtgttcaccttctaaagcttttctacgtggaaacaaagcatgcaagcttgcgcttgagaatttacccgatgaggtttacgatacg |
38533207 |
T |
|
| Q |
101 |
gagtgggatcttattatgatcgatgcgccgaaagggtatttcgcggaggcgccggggagaatggcggcggtgttttcagctgctgttatggcgaggaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38533208 |
gagtgggatcttattatgatcgatgcgccgaaagggtatttcgcggaggcgccggggagaatggcggcggtgttttcagctgctgttatggcgaggaata |
38533307 |
T |
|
| Q |
201 |
ggaagggatctggtgtgacgcatgtgtttttgcatgatgt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38533308 |
ggaagggatctggtgtgacgcatgtgtttttgcatgatgt |
38533347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 83 - 240
Target Start/End: Complemental strand, 34715272 - 34715115
Alignment:
| Q |
83 |
gatgaggtttacgatacggagtgggatcttattatgatcgatgcgccgaaagggtatttcgcggaggcgccggggagaatggcggcggtgttttcagctg |
182 |
Q |
| |
|
|||||| ||||||| |||||||||||| | || |||||||||||||||| ||| ||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
34715272 |
gatgagatttacgaaacggagtgggatttgataatgatcgatgcgccgagaggttatttcgcggaggcgccggggagaatggcggcgatattttcaatga |
34715173 |
T |
|
| Q |
183 |
ctgttatggcgaggaataggaagggatctggtgtgacgcatgtgtttttgcatgatgt |
240 |
Q |
| |
|
| || |||||||| ||||| || || || ||||||||||| ||||||||||||||||| |
|
|
| T |
34715172 |
cggtgatggcgagaaatagaaaaggttccggtgtgacgcacgtgtttttgcatgatgt |
34715115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University