View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9459_low_41 (Length: 237)
Name: NF9459_low_41
Description: NF9459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9459_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 33 - 223
Target Start/End: Original strand, 33357976 - 33358166
Alignment:
| Q |
33 |
agttggcaaggtatgtgttctaagttgattaacacttaaccaaaactcgcatgcttgtgttagctttaaaaaagcattgccaacaaaaagcaaggaatga |
132 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33357976 |
agttggcaaggtatgtgttgtaagttgattaacacttaaccaaaactcgcatgcttgtgttagctttaaaaaagcaatgccaacaaaaagcaaggaatga |
33358075 |
T |
|
| Q |
133 |
atccactcaagtttttatgtaannnnnnnnnnagtagtaagtcatatttaagtgttttatgttatcatgaaaggaaattaaaatttataat |
223 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||| | ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33358076 |
atccactcaagtttttatgtaaattttttttgagtagttagtcatgtataagtgttttatgttatcatgaaaggaaattaaaacttataat |
33358166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University