View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9460_low_29 (Length: 251)
Name: NF9460_low_29
Description: NF9460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9460_low_29 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 11151233 - 11151473
Alignment:
| Q |
11 |
cagagaccatatgatacccacgcgatcgaagatctttaggcccatcaaacggcaatgcaaaacccgacnnnnnnncatcatctttctcactcttcctctt |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11151233 |
cagaaaccatatgatacccacgcgatcgaagatctttaggcccatcaaacggcaatgcaaaacccgacaaaaaaacatcatctttctcactcttcctctt |
11151332 |
T |
|
| Q |
111 |
caacaccttcctctcagcttccatcaaagtctccctcactttcttattccccggatcccacaaatatcccatgctagcactcaaatccaacggtcccatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11151333 |
caacaccttcctctcagcttccatcaacgtctccctcactttcttattccccggatcccacaaatatcccatgctagcactcaaatccaacggtcccatt |
11151432 |
T |
|
| Q |
211 |
tgcacacaatcaaccccatcaacggctgcaattttttcaac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11151433 |
tgcacacaatcaaccccatcaacggctgcaattttttcaac |
11151473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University