View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9460_low_38 (Length: 238)
Name: NF9460_low_38
Description: NF9460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9460_low_38 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 15 - 238
Target Start/End: Original strand, 47836025 - 47836249
Alignment:
| Q |
15 |
atttcttgcctaataaaacctcatgtcaattttttaatttacgtacaattaaaactatcttgataaaaaatggaatctaaattgtaggatcttattttat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47836025 |
atttcttgcctaataaaacctcatgtcaattttttaatttacgtacaattaaaactatcttgataaaaaatggaatctaaattgtaggatcatattttat |
47836124 |
T |
|
| Q |
115 |
ggtacgatgagaccaacgcggtcctttgcctttaaataaatccttttcaagtcatttcttcttcgttctcgct-nnnnnnngtaggaaattctttgccaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
47836125 |
ggtacgatgagaccaacgcggtcctttgcctttaaataaatccttttcaagtcatttcttcttagttctcgctaaaaaaaagtaggaaattctttgcctt |
47836224 |
T |
|
| Q |
214 |
taaataaatcaataagaaattcttc |
238 |
Q |
| |
|
|||||||||||||| |||||||||| |
|
|
| T |
47836225 |
taaataaatcaataggaaattcttc |
47836249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University