View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9460_low_49 (Length: 216)
Name: NF9460_low_49
Description: NF9460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9460_low_49 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 52725111 - 52725308
Alignment:
| Q |
19 |
ccattcacagcacaacccctgcgcttccgattaaactgtctttgaagaatagtaataataataaggttgtttctcaaaggagattacccaaatggtggcc |
118 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52725111 |
ccattcacagcacaacccctgctctgccgattaaacgttctttgaagaatagtaataataataaggttgtttctcaaaggaaattacccaaatggtggcc |
52725210 |
T |
 |
| Q |
119 |
acctattaacaacagcaatgtcaatgcttttgatatggacctaaatgagcaagatgaatacaagagggatgcttacagactcgttcgatgtctgtctt |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52725211 |
acctattaacaacaacaatgtcaatgcttttgatatggacctaaatgagcaagatgaatacaagagggatgcttacagactcgttcgatgtctgtctt |
52725308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University