View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9460_low_50 (Length: 214)

Name: NF9460_low_50
Description: NF9460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9460_low_50
NF9460_low_50
[»] chr6 (1 HSPs)
chr6 (16-191)||(32958474-32958649)
[»] scaffold0054 (1 HSPs)
scaffold0054 (18-126)||(38473-38579)


Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 191
Target Start/End: Original strand, 32958474 - 32958649
Alignment:
16 cagagaaggcaatatcatcatatttatatagttgttgttcgccttttcttttgagagaatgaagttcagcggttgcagattggaatacgagtgaatgaga 115  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32958474 cagagaaggcaatatcatcatatatatatagttgttgttcgccttttcttttgagagaatgaagttcagcggttgcagattggaatacgagtgaatgaga 32958573  T
116 ttgttgaatacggatggtacgagtaaggatggtggtcgagatggttgtggtggtttgtttagagtaaataacggta 191  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
32958574 ttgttgaatacggatggtacgagtaaggatggtggtcgagatgtttgtggtggtttgtttagagtaaataacggta 32958649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0054 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: scaffold0054
Description:

Target: scaffold0054; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 18 - 126
Target Start/End: Complemental strand, 38579 - 38473
Alignment:
18 gagaaggcaatatcatcatatttatatagttgttgttcgccttttcttttgagagaatgaagttcagcggttgcagattggaatacgagtgaatgagatt 117  Q
    ||||||||||||||||||| | ||||  | |||||||| ||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||    
38579 gagaaggcaatatcatcatgtctata--gctgttgttcacctttttgtttgagagaatgaagttcagcggttgcagattggaatacgagtgaatgagatt 38482  T
118 gttgaatac 126  Q
    |||||||||    
38481 gttgaatac 38473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University