View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9460_low_51 (Length: 214)
Name: NF9460_low_51
Description: NF9460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9460_low_51 |
 |  |
|
| [»] scaffold0054 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 191
Target Start/End: Original strand, 32958474 - 32958649
Alignment:
| Q |
16 |
cagagaaggcaatatcatcatatttatatagttgttgttcgccttttcttttgagagaatgaagttcagcggttgcagattggaatacgagtgaatgaga |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958474 |
cagagaaggcaatatcatcatatatatatagttgttgttcgccttttcttttgagagaatgaagttcagcggttgcagattggaatacgagtgaatgaga |
32958573 |
T |
 |
| Q |
116 |
ttgttgaatacggatggtacgagtaaggatggtggtcgagatggttgtggtggtttgtttagagtaaataacggta |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32958574 |
ttgttgaatacggatggtacgagtaaggatggtggtcgagatgtttgtggtggtttgtttagagtaaataacggta |
32958649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 18 - 126
Target Start/End: Complemental strand, 38579 - 38473
Alignment:
| Q |
18 |
gagaaggcaatatcatcatatttatatagttgttgttcgccttttcttttgagagaatgaagttcagcggttgcagattggaatacgagtgaatgagatt |
117 |
Q |
| |
|
||||||||||||||||||| | |||| | |||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38579 |
gagaaggcaatatcatcatgtctata--gctgttgttcacctttttgtttgagagaatgaagttcagcggttgcagattggaatacgagtgaatgagatt |
38482 |
T |
 |
| Q |
118 |
gttgaatac |
126 |
Q |
| |
|
||||||||| |
|
|
| T |
38481 |
gttgaatac |
38473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University