View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9460_low_52 (Length: 212)
Name: NF9460_low_52
Description: NF9460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9460_low_52 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 15 - 195
Target Start/End: Original strand, 35466157 - 35466340
Alignment:
| Q |
15 |
tggtggtggttaaaagcttacaaatctgattatttttacgatctgcattcttgatagtccaatccatcactttgtcttggttacgctaatatataaccgc |
114 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35466157 |
tggtggtagttaaaagcttacaaatctgattatttttacgatctgcatttttggtagtccaatccgtcactttgtcttggttacgctaatatataaccgc |
35466256 |
T |
|
| Q |
115 |
aaactatagacagtttattcggtgta---tattgatactttgtttccttacctattacgcacttcttgtgctttataggttttt |
195 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35466257 |
aaactttagacagtttattcggtgtatattattgatactttgtttccttacctattaggcacttcttgtgctttataggttttt |
35466340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 14 - 106
Target Start/End: Complemental strand, 13058977 - 13058885
Alignment:
| Q |
14 |
ttggtggtggttaaaagcttacaaatctgattatttttacgatctgcattcttgatagtccaatccatcactttgtcttggttacgctaatat |
106 |
Q |
| |
|
||||||||||||||| ||||| || ||||||| |||||||||| | |||||||||| || |||| |||||||||||||| |||||||||||| |
|
|
| T |
13058977 |
ttggtggtggttaaaggcttataagtctgattgtttttacgattttcattcttgatggttcaatatatcactttgtcttgattacgctaatat |
13058885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 14 - 88
Target Start/End: Original strand, 3310427 - 3310501
Alignment:
| Q |
14 |
ttggtggtggttaaaagcttacaaatctgattatttttacgatctgcattcttgatagtccaatccatcactttg |
88 |
Q |
| |
|
|||| ||||||||||| ||||||||||| ||||||||||||| |||||||||| | |||| |||| ||| |||| |
|
|
| T |
3310427 |
ttggcggtggttaaaaacttacaaatcttgttatttttacgatttgcattcttggtggtccgatccgtcattttg |
3310501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University