View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9460_low_53 (Length: 211)
Name: NF9460_low_53
Description: NF9460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9460_low_53 |
 | |
|
| [»] scaffold0376 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0376 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: scaffold0376
Description:
Target: scaffold0376; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 190
Target Start/End: Original strand, 1627 - 1802
Alignment:
| Q |
16 |
ttggtggtagttgctgaacttctgctgtattggggacaatggtatattaattaccgtactgctttaggaatgtttaacacgggaaa-tcacattttacta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1627 |
ttggtggtagttgctgaacttctgctgtattggggacaatggtatattaattaccgtactgctttaggaatgtttaacacgggaaaatcacattttacta |
1726 |
T |
|
| Q |
115 |
aatagataaaaatgccaaaaacaaggtttgtaacttgttactccttcttctattctattctattctatgaataatg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1727 |
aatagataaaaatgccaaaaacaaggtttgtaacttgttactccttcttctattctattctattctatgaataatg |
1802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University