View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_high_31 (Length: 250)
Name: NF9461_high_31
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_high_31 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 7 - 250
Target Start/End: Original strand, 2719525 - 2719768
Alignment:
| Q |
7 |
gcagagagaatcaaagcagatcaaagcacattcatccattcctaaggactcacatatagtagagaatctatgcttgtgggcagtggctataaaataaaga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2719525 |
gcagagagaatcaaagcagatcaaagcacattcatccattcctaaggactcacatatagtagagaatctatgcttgtgggcagtggctataaaataaaga |
2719624 |
T |
 |
| Q |
107 |
taaatagcaacaacaaatgaagaatattgctcaaaacaataaagagtataaaatcatgcttgtaactatcacagttgtttatcaaatccttcttgattga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2719625 |
taaatagcaacaacaaatgaagaatattgctcaaaacaataaagagtataaaatcatgcttgtaactatcacagttgtttatcaaatccttcttgattga |
2719724 |
T |
 |
| Q |
207 |
tagatggataccctcaagctatatagttttttcatttatctttt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2719725 |
tagatggataccctcaagctatatagttttttcatttatctttt |
2719768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University