View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_high_38 (Length: 243)
Name: NF9461_high_38
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 21 - 224
Target Start/End: Complemental strand, 44495498 - 44495295
Alignment:
| Q |
21 |
ggtgtatgggttatattttatcactcactctgacaatggaagaataagaaggttcacgttgaaggtgttttgctcagcagtatgtcaactaatatcaaat |
120 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44495498 |
ggtgtatgggttatattttatcactc----tggcaatggaagaataaggaggctcacgttgaaggtgttttgctcagcagtatgtcaactaatatcaaat |
44495403 |
T |
 |
| Q |
121 |
aaaaggaatatggaatgagcagtgctatatgtcgcgaccaaaggttcacgaattgttaaatctttatatttcttcacactaacagt----atcagcggtg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44495402 |
aaaaggaatatggaatgagcagtgctatatgtcgcaaccaaaggttctcgaattgttaaatctttatatttcttcacactaacagtatcaatcagcggtg |
44495303 |
T |
 |
| Q |
217 |
ctactctg |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
44495302 |
ctactctg |
44495295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University