View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_high_46 (Length: 229)
Name: NF9461_high_46
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_high_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 45969310 - 45969088
Alignment:
| Q |
1 |
tccatagttttaactttgaaacttgcaggcatcaagccttgtcctgggctatagcagtccactgtcttctcccaactctattaaaatagaaaagagaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45969310 |
tccatagttttaactttgaaacttgcaggcatcaagccttgtcctgggctatagcagtccactgtcttctcccaactctattaaaatagaaaagagaaga |
45969211 |
T |
 |
| Q |
101 |
aaagttatatcatatatccttgtatcatgttacaatatattaacgaataaaccatacataagtaacatatgtttgtacatagtttaatatgagcaaggac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45969210 |
aaagttatatcatatatccttgtatcatgttacaatatattaacgaataaaccatacataagtaacatatgtttgtacatagtttaatatgagcaaggac |
45969111 |
T |
 |
| Q |
201 |
aatatatttttgacatatccatg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
45969110 |
aatatatttttgacatatccatg |
45969088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 11 - 79
Target Start/End: Original strand, 37654185 - 37654253
Alignment:
| Q |
11 |
taactttgaaacttgcaggcatcaagccttgtcctgggctatagcagtccactgtcttctcccaactct |
79 |
Q |
| |
|
||||||||||||| ||||||||||| || |||||||| || ||||||||||| || ||||||||||||| |
|
|
| T |
37654185 |
taactttgaaactagcaggcatcaaaccctgtcctggactgtagcagtccacagttttctcccaactct |
37654253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 79
Target Start/End: Original strand, 50761944 - 50762010
Alignment:
| Q |
13 |
actttgaaacttgcaggcatcaagccttgtcctgggctatagcagtccactgtcttctcccaactct |
79 |
Q |
| |
|
|||||||| || || |||||||| ||||| |||||||| ||||| || || |||||||||||||||| |
|
|
| T |
50761944 |
actttgaagctcgctggcatcaacccttgccctgggctgtagcaatcaacggtcttctcccaactct |
50762010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University