View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_high_51 (Length: 208)
Name: NF9461_high_51
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_high_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 16 - 198
Target Start/End: Original strand, 50916352 - 50916534
Alignment:
| Q |
16 |
atactccgtatacaatgcatatatacttgaagttgatgttcagaatatccttgaatcttttggatggtgggagggtgaaacttgctaggagatatcatca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50916352 |
atactccgtatacaatgcatatatacttgaagttgatgttcagaatatccttgaatcttttggatggtgggagggtgaaacttgctaggagatatcatca |
50916451 |
T |
 |
| Q |
116 |
ggcattccaaaggcatcaatctctaggaactttcctgataatggaatcatttgttgcatgagtcacagtacagatagattgta |
198 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50916452 |
ggcattccaaaggcattaatctctaggaactttcctgataatggaatcatttgttgcatgagtcacagtacagatagattgta |
50916534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 45 - 199
Target Start/End: Original strand, 42350703 - 42350863
Alignment:
| Q |
45 |
aagttgatgttcagaatatccttgaatcttttgga--------tggtgggagggtgaaacttgctaggagatatcatcaggcattccaaaggcatcaatc |
136 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||| |||||| |||||||||||||| |||| ||||||||||||||| | ||| || ||| |
|
|
| T |
42350703 |
aagttgatgttcagaatatccttgaaactcttggagccggacatggtggcagggtgaaacttgcaaggaaatatcatcaggcattgga--ggcgtcgatc |
42350800 |
T |
 |
| Q |
137 |
tctaggaactttcctgataatggaatcatttgttgcatgagtcacagtacagatagattgtat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
42350801 |
tctaggaactttcctgataatggaatcatttgttgcatgagtcacaatacagacggattgtat |
42350863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University