View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_high_52 (Length: 203)
Name: NF9461_high_52
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_high_52 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 82 - 203
Target Start/End: Complemental strand, 32377529 - 32377408
Alignment:
| Q |
82 |
cttagaatatggattattatcctattctacctctattgtggttaaaaaatatagggcacctttattggtttcaatgttgcaaccgagtatttcaatgata |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32377529 |
cttagaatatggattattatcctattctacctctattgtggttaaaaaatatagggcacatttattggtttcaatgttgcaaccgagtatttcaatgata |
32377430 |
T |
 |
| Q |
182 |
tgttgtgagtgttgaaagtcca |
203 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32377429 |
tgttgtgagtgttgaaagtcca |
32377408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University