View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_low_113 (Length: 244)
Name: NF9461_low_113
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_low_113 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 13 - 178
Target Start/End: Complemental strand, 31972362 - 31972197
Alignment:
| Q |
13 |
aaatcaatgcatggttcctctggtaaattgaagagagttcttaatccacttctaaatctgtatgaatatacactttgaagcccagcacatcctagtaaac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31972362 |
aaatcaatgcatggttcctctggtaaattgaagagagttcttaatccacttctaaatctgtatgaatatacactttgaagcccagcacatcctagcaaac |
31972263 |
T |
|
| Q |
113 |
aaaatatcaaccgagcttgtgtagcagctgaaataatttcagaaaaagttagtaataaaaatattt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31972262 |
aaaatatcaaccgagcttgtgtagcagctgaaataatttcagaaaaagttagtaataaaaatattt |
31972197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 173 - 236
Target Start/End: Complemental strand, 31972178 - 31972115
Alignment:
| Q |
173 |
atatttggaatttagaatattaaaatatttaattttactttactcacatgttcttccttggtct |
236 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31972178 |
atatatggaatttagaatattaaaatatttaattttactttactcacatgttcttccttggtct |
31972115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University