View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_low_119 (Length: 242)
Name: NF9461_low_119
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_low_119 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 37184775 - 37184557
Alignment:
| Q |
1 |
tgtaatacaaaccatatatgttaacattcaatactgttggttgtttacaaagagaatgtacaatgacatgtttcttgtgtttcaacttgttgccttgtgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37184775 |
tgtaatacaaaccatatatgttaacattcaatactgttggttgtttacaaagagaatgtacaatgacatgtttcttgtgtttcaacttgttgccttgtgc |
37184676 |
T |
 |
| Q |
101 |
atctgttcagtcacagtcttggaaatgccctgtctctgctagaagtagaaagcaaataacaccaaattccaacatgatttctgatcgcggtgatttgaga |
200 |
Q |
| |
|
|| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37184675 |
atatgttcagtcacagtcttgg------gctgtctctgctagaagtagaaagcaaataacaccaaattccaacatgatttctgatcgctgtgatttgaga |
37184582 |
T |
 |
| Q |
201 |
ttttctaaaaggcttatagaaactg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37184581 |
ttttctaaaaggcttatagaaactg |
37184557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 81 - 145
Target Start/End: Complemental strand, 37212947 - 37212883
Alignment:
| Q |
81 |
ttcaacttgttgccttgtgcatctgttcagtcacagtcttggaaatgccctgtctctgctagaag |
145 |
Q |
| |
|
||||||||||||||||||| || |||||||||| ||||| || | |||||||||||| ||||||| |
|
|
| T |
37212947 |
ttcaacttgttgccttgtggatatgttcagtcagagtctagggattgccctgtctctactagaag |
37212883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 175 - 224
Target Start/End: Original strand, 5364436 - 5364485
Alignment:
| Q |
175 |
tgatttctgatcgcggtgatttgagattttctaaaaggcttatagaaact |
224 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
5364436 |
tgatttctgatcgccgtgactttagattttctaaaaggcttatagaaact |
5364485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University