View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_low_122 (Length: 240)
Name: NF9461_low_122
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_low_122 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 14 - 240
Target Start/End: Original strand, 32708357 - 32708583
Alignment:
| Q |
14 |
agataaccaacaacacaccacaactttctaaatatattcgagaaaatgggcgtttgtaaaccctaaataaatttttatggatttctagtcaatactacgg |
113 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32708357 |
agataaccagcaacacaccacaactttctaaatatattcgagaaaatgggcgtttgtaaaccctaaataattttttatggatttctagtcaatactacgg |
32708456 |
T |
 |
| Q |
114 |
tgacattgacaaatttagttttttccttggacatccgatcaactaagatttcttgatagcgatcaaagagctcatcaataatagactctccaaagtggct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32708457 |
tgacattgacaaatttagttttttccttggacatccgatcaactaagatttcttgatagcgatcaaagagctcatcaataatagactctccaaagtgtct |
32708556 |
T |
 |
| Q |
214 |
aactagcaaaggttcagaaacggctct |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32708557 |
aactagcaaaggttcagaaacggctct |
32708583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University