View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_low_135 (Length: 229)
Name: NF9461_low_135
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_low_135 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 81 - 229
Target Start/End: Complemental strand, 2719949 - 2719801
Alignment:
| Q |
81 |
ctcatatgctccatgggaagtaatcgtgtttaacacacgactagatattaaatgcggacannnnnnngtattatgctatgattcatatatttgttcacga |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
2719949 |
ctcatatgctccatgggaagtaatcgtgtttaacgcacgatcagatactaaatgcggacacttttttctactatgctaggattcatatatttgttcacga |
2719850 |
T |
 |
| Q |
181 |
tattgtggagactgacctctttcgttagatccaaccctggttgatttgt |
229 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2719849 |
tattgtggagactgatctctttcgttagatccaaccctggttgatttgt |
2719801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 6 - 47
Target Start/End: Complemental strand, 2720024 - 2719983
Alignment:
| Q |
6 |
aaatagtacctaaaagttcatgttcattttccaatataaata |
47 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2720024 |
aaatagtacctaaaagttcatgttccttttccaatataaata |
2719983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University