View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9461_low_151 (Length: 203)

Name: NF9461_low_151
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9461_low_151
NF9461_low_151
[»] chr1 (1 HSPs)
chr1 (82-203)||(32377408-32377529)


Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 82 - 203
Target Start/End: Complemental strand, 32377529 - 32377408
Alignment:
82 cttagaatatggattattatcctattctacctctattgtggttaaaaaatatagggcacctttattggtttcaatgttgcaaccgagtatttcaatgata 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
32377529 cttagaatatggattattatcctattctacctctattgtggttaaaaaatatagggcacatttattggtttcaatgttgcaaccgagtatttcaatgata 32377430  T
182 tgttgtgagtgttgaaagtcca 203  Q
    ||||||||||||||||||||||    
32377429 tgttgtgagtgttgaaagtcca 32377408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University