View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_low_25 (Length: 415)
Name: NF9461_low_25
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 386; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 1 - 410
Target Start/End: Original strand, 12635455 - 12635863
Alignment:
| Q |
1 |
tattatgttactgaagtgaatggaaagagggtatgatgtttattggaacctgaaggggagcactgcttttatgatggtaattacaaagctcattggtatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12635455 |
tattatgttactgaagtgaatggaaagagggtatgatgtttattggaacctgaaggggagcactgcttttatgatggtaattacaaagctcattggtatt |
12635554 |
T |
|
| Q |
101 |
tactgcattggaaacacgccagtcattataacatatggaatggttgagattagcatagattgaaatcaacggccaccatacattggcgcccaaaatcatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12635555 |
tactgcattggaaacacgccagtcattataacatatggaatggttgagattagcatagattgaaatcaacggccaccatacattggcgcccaaaatcatc |
12635654 |
T |
|
| Q |
201 |
ttcaatttcctaccaagagaaatccttattaatttatcttctttcctctctcaaatataatcactatccaatattgtgtttacctaccctagatatccac |
300 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12635655 |
ttcaatttcctaccaagag-aatccttattaatttatcttctttcctctctcaaatataatcactatccaatattgcgtttacctaccctagatatccac |
12635753 |
T |
|
| Q |
301 |
cacaaatccgtcaatccaaaactccttttgagtttcttcttcaatggtgttcgctctctcacaagagttattaacttctcttcgtgttccctctccctgc |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12635754 |
cacaaatccgtcaatccaaaactccttttgagttttttcttcgatggtgttcgctctctcacaagagttattaacttctcttcgtgttccctctccctgc |
12635853 |
T |
|
| Q |
401 |
ctttgcttct |
410 |
Q |
| |
|
||||| |||| |
|
|
| T |
12635854 |
ctttgattct |
12635863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 7e-22; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 142 - 199
Target Start/End: Original strand, 38511200 - 38511257
Alignment:
| Q |
142 |
ggttgagattagcatagattgaaatcaacggccaccatacattggcgcccaaaatcat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38511200 |
ggttgagattagcatagattgaaatcaacggccaccaaacattggcgcccaaaatcat |
38511257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 143 - 194
Target Start/End: Original strand, 37222948 - 37222999
Alignment:
| Q |
143 |
gttgagattagcatagattgaaatcaacggccaccatacattggcgcccaaa |
194 |
Q |
| |
|
||||||||||||||| |||||||| |||||||| || ||||||||||||||| |
|
|
| T |
37222948 |
gttgagattagcataaattgaaattaacggccatcaaacattggcgcccaaa |
37222999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University