View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_low_47 (Length: 346)
Name: NF9461_low_47
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 333
Target Start/End: Complemental strand, 45229298 - 45228965
Alignment:
| Q |
1 |
tcaaacaagggaaatgccttgaggatgagagcgatgccgagacgttttggatcggaaaagagta-gagcgaaggaagcgataacaacaccgacgatatca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45229298 |
tcaaacaagggaaatgccttgaggatgagagcgatgcccagacgttttggatcggaaaagagtaagagcgaaggaagcgataacaacaccgacgatatca |
45229199 |
T |
|
| Q |
100 |
gcaatggcgtctttgaaggaagcaccggaagagcggaaatagccaaggtgatcggcggcttctttggcggcgccggcgaggagagaaacgacggatccaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45229198 |
gcaatggcgtctttgaaggaagcaccggaagagcggaaatagccaaggtgatcggcggcttctttggcggcgccggcgaggagagaaacgacggatccaa |
45229099 |
T |
|
| Q |
200 |
tggaaatggcgtggcggcggaggaaaggatgtgaagtaaaggaagcgagagcgtagaagagaagagtgagagtgaaacacatgatgatgtgatagaattt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45229098 |
tggaaatggcgtggcggcggaggaaaggatgtgaagtgaaggaagcgagagcgtagaagagaagagtgagagtgaaacacatgatgatgtgatagaattt |
45228999 |
T |
|
| Q |
300 |
gtctgcgcctaaccatgggtctgtgtcttcatct |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45228998 |
gtctgcgcctaaccatgggtctgtgtcttcatct |
45228965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University