View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_low_73 (Length: 291)
Name: NF9461_low_73
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_low_73 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 45 - 163
Target Start/End: Original strand, 23085680 - 23085798
Alignment:
| Q |
45 |
taatcactcgaaaaaatctgaagccgcagcttcgacaatggtagccataaaactagtaggatccattaaaacagcgtcgattagtaacttgaccactaat |
144 |
Q |
| |
|
|||||||||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23085680 |
taatcactcgaaaaaacctgaagttgcggcttcgacaatggtagccataaaactagtaggatccattaaaacaacgtcgattagtaacttgaccactaat |
23085779 |
T |
 |
| Q |
145 |
ttgccggtaaatttcatga |
163 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
23085780 |
ttaccggtaaatttcatga |
23085798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 101 - 163
Target Start/End: Original strand, 23056601 - 23056663
Alignment:
| Q |
101 |
taggatccattaaaacagcgtcgattagtaacttgaccactaatttgccggtaaatttcatga |
163 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23056601 |
taggatccattaacacaacgtcgattagtaacttgaccactaatttgccggtaaatttcatga |
23056663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 80 - 246
Target Start/End: Original strand, 8255201 - 8255367
Alignment:
| Q |
80 |
caatggtagccataaaactagtaggatccattaaaacagcgtcgattagtaacttgaccactaatttgccggtaaatttcatgacagcacgctttctccc |
179 |
Q |
| |
|
||||||||| ||| || |||| |||||||||||||| ||||||||||| | ||||||||||| ||| |||||||||||| ||||||||||||||| |
|
|
| T |
8255201 |
caatggtagtgatagaattagttggatccattaaaactatgtcgattagtacgtccaccactaatttcccgataaatttcatgaaagcacgctttctccc |
8255300 |
T |
 |
| Q |
180 |
ttttgacctcttattattattcgaactttgaagaaccatatccttgaaacacttcacatgaacacaa |
246 |
Q |
| |
|
| ||||||| || ||||||||| | ||| ||||| |||||| |||||||| ||||||||||||| |
|
|
| T |
8255301 |
tcttgacctatttttattattcaatatttcaagaatcatatcattgaaacatgacacatgaacacaa |
8255367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University