View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_low_90 (Length: 253)
Name: NF9461_low_90
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_low_90 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 12 - 253
Target Start/End: Complemental strand, 37055627 - 37055386
Alignment:
| Q |
12 |
aggagcagagaagtaaagaaggcctggtacaactacaactgccaaaggttcaggggttccctgctttgcttggagtagcattaaagacagtactgtttca |
111 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37055627 |
aggaacagggaagtaaagaaggcctggtacaactacaactgccaaaggttcaggggttccctgctttgcttggagtagcattaaagacagtactgtttca |
37055528 |
T |
 |
| Q |
112 |
gatcttattttcattcaccagcactaaccaaatgaaaaaatattcannnnnnnngatgnnnnnnnnnnnnnggaaacaagcttttataagaggaaagctg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
37055527 |
gatcttattttcattcaccagcactaaccaaatgaaaaaatattcatttttttttatgaaaaaaacaaaaaggaaacaagcttttataagaggaaagctg |
37055428 |
T |
 |
| Q |
212 |
cattaacttttagttggaagaaagaaaaagaaaatgagttgt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37055427 |
cattaacttttagttggaagaaagaaaaagaaaatgagttgt |
37055386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University