View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_low_94 (Length: 252)
Name: NF9461_low_94
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_low_94 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 53942781 - 53942581
Alignment:
| Q |
14 |
aagcataggattggatttgagttctaaggttagaagttgaacatgttaatgcagaatttggaaatggataagatgaatgaattggaggaaaagaacagag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53942781 |
aagcataggattggatttgagttctaaggttagaaattgaacatgttaatgcagaatttggaaatggataagatgaatgaattggaggaaaagaacagag |
53942682 |
T |
|
| Q |
114 |
tgaagaaaggattgtcatttttgttgttgttttcgtggctgcatctgcttcttgttcttgttttcgataagtgtctttgtttctatttggtgaaacaatc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
53942681 |
tgaagaaaggattgtcatttttgttgttgtgttcgtggctgcatctgcttcttgttcttgttttcgataagtgtctttgtttctatttggtgaaactatc |
53942582 |
T |
|
| Q |
214 |
a |
214 |
Q |
| |
|
| |
|
|
| T |
53942581 |
a |
53942581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University