View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9461_low_97 (Length: 251)
Name: NF9461_low_97
Description: NF9461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9461_low_97 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 32958413 - 32958173
Alignment:
| Q |
11 |
caaaggcaatagcgttgaagaagccaacaaagttattattacacaaatgcaaaacaatgttgctttaattaacccacgtgagagaatttcatgtaagctt |
110 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958413 |
caaaggcaatagcgttgaagacgccaacaaagttattattacacaaatgcaaaacaatgtggctttaattaacccacgtgagagaatttcatgtaagctt |
32958314 |
T |
 |
| Q |
111 |
gtttcaaaaagctcaatctcccacaatgttaggatttttcgatttgcgttaccttatgaagaccaactattgggtttgccaattgggaaacacttatttt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32958313 |
gtttcaaaaagctcaatctcccacaatgttaggatttttcgatttgcgttaccttatgaagaccaactattgggtttaccaattgggaaacacttatttt |
32958214 |
T |
 |
| Q |
211 |
tatgtgacactattgaagaaaagttatgcatgagagctttc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958213 |
tatgtgacactattgaagaaaagttatgcatgagagctttc |
32958173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University