View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9462_high_4 (Length: 215)
Name: NF9462_high_4
Description: NF9462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9462_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 17 - 88
Target Start/End: Complemental strand, 7377050 - 7376979
Alignment:
| Q |
17 |
aagcacaacctgttcaatgaaaatggctaaagaactaccacaacagcaacatcttcaacttggttactgtct |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7377050 |
aagcacaacctgttcaatgaaaatggctaaagaactaccacaacagcaacatcttcaacttggttactgtct |
7376979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 201
Target Start/End: Complemental strand, 7376901 - 7376866
Alignment:
| Q |
166 |
attctcctgttctgtctcataacacaagtttctgtg |
201 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7376901 |
attctcctgttctgtctcacaacacaagtttctgtg |
7376866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University