View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9462_high_4 (Length: 215)

Name: NF9462_high_4
Description: NF9462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9462_high_4
NF9462_high_4
[»] chr4 (2 HSPs)
chr4 (17-88)||(7376979-7377050)
chr4 (166-201)||(7376866-7376901)


Alignment Details
Target: chr4 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 17 - 88
Target Start/End: Complemental strand, 7377050 - 7376979
Alignment:
17 aagcacaacctgttcaatgaaaatggctaaagaactaccacaacagcaacatcttcaacttggttactgtct 88  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7377050 aagcacaacctgttcaatgaaaatggctaaagaactaccacaacagcaacatcttcaacttggttactgtct 7376979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 201
Target Start/End: Complemental strand, 7376901 - 7376866
Alignment:
166 attctcctgttctgtctcataacacaagtttctgtg 201  Q
    ||||||||||||||||||| ||||||||||||||||    
7376901 attctcctgttctgtctcacaacacaagtttctgtg 7376866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University