View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9462_low_15 (Length: 204)

Name: NF9462_low_15
Description: NF9462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9462_low_15
NF9462_low_15
[»] chr7 (2 HSPs)
chr7 (57-188)||(28101252-28101383)
chr7 (14-49)||(28101372-28101407)


Alignment Details
Target: chr7 (Bit Score: 132; Significance: 9e-69; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 57 - 188
Target Start/End: Complemental strand, 28101383 - 28101252
Alignment:
57 agcaataaagttaaacgctgtagaatgtgtacttttctaaagtagtggcatgacaaaaatcactgttcactattatgcattgcacgtatgccaaaattta 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28101383 agcaataaagttaaacgctgtagaatgtgtacttttctaaagtagtggcatgacaaaaatcactgttcactattatgcattgcacgtatgccaaaattta 28101284  T
157 ttttacattgcatagtatgttctgttggcttt 188  Q
    ||||||||||||||||||||||||||||||||    
28101283 ttttacattgcatagtatgttctgttggcttt 28101252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 49
Target Start/End: Complemental strand, 28101407 - 28101372
Alignment:
14 catagggattagttgcaacatcaaagcaataaagtt 49  Q
    ||||||||||||||||||||||||||||||||||||    
28101407 catagggattagttgcaacatcaaagcaataaagtt 28101372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University