View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9462_low_15 (Length: 204)
Name: NF9462_low_15
Description: NF9462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9462_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 9e-69; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 57 - 188
Target Start/End: Complemental strand, 28101383 - 28101252
Alignment:
| Q |
57 |
agcaataaagttaaacgctgtagaatgtgtacttttctaaagtagtggcatgacaaaaatcactgttcactattatgcattgcacgtatgccaaaattta |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28101383 |
agcaataaagttaaacgctgtagaatgtgtacttttctaaagtagtggcatgacaaaaatcactgttcactattatgcattgcacgtatgccaaaattta |
28101284 |
T |
 |
| Q |
157 |
ttttacattgcatagtatgttctgttggcttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28101283 |
ttttacattgcatagtatgttctgttggcttt |
28101252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 49
Target Start/End: Complemental strand, 28101407 - 28101372
Alignment:
| Q |
14 |
catagggattagttgcaacatcaaagcaataaagtt |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28101407 |
catagggattagttgcaacatcaaagcaataaagtt |
28101372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University