View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9463_high_6 (Length: 296)
Name: NF9463_high_6
Description: NF9463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9463_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 17 - 287
Target Start/End: Complemental strand, 41934062 - 41933791
Alignment:
| Q |
17 |
ccagcaagtgctttggtctgcacactctggtcgggttggatcagatactcagtccgtgtctcctcttctaatgctttctcactatatcaaagaaaatatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41934062 |
ccagcaagtgctttggtctgcacactctggtcgggttggatcagatactcagtccgtgtctcctcttctaatgctttctcactatatcaaagaaaatatg |
41933963 |
T |
|
| Q |
117 |
ttcactgtttcatccaccttgtctttt-ggagttaagggaagaaccagtaacattgtgtgtcacaccacaaaacactttgacataaatactattctgcta |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41933962 |
ttcactgtttcatccaccttgtctttttggagttaagggaagaaccagtaacattgtgtgtcacaccacaaaacactttgacataaatactattctgcta |
41933863 |
T |
|
| Q |
216 |
gtaaactcaacaacattgccacccatatcatcaacactattttggtacctgttttcattttcagatcaccta |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41933862 |
gtaaactcaacaacattgccacccatatcatcaacactattttggtacctgttttcattttcagatcaccta |
41933791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University