View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9464_low_7 (Length: 242)
Name: NF9464_low_7
Description: NF9464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9464_low_7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 43148572 - 43148349
Alignment:
| Q |
19 |
aacctaaccggctaaaggctaatccacagcaactataattataaactttaaaaagataacatttacaatacaatatgaaactccaannnnnnnnnnnnnn |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43148572 |
aacctaaccggctaaaggctaatccacaacaactataattataaactttaaaaagataacatttacaatacaatatgaaactccaattgtttgttctttt |
43148473 |
T |
|
| Q |
119 |
nnnnnnnnnnatgtcttatgcagatgcaaggaagcaacctttgtcggatggttggagtcgaatcaaagatatcaacaacccacatgtgattgatatcgct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43148472 |
tgttgttttgatgtcttatgcagatgcaaggaagcaacctttgtcggatggttggagtcgaatcaaagatatcaacaacccacatgtgattgatatcgct |
43148373 |
T |
|
| Q |
219 |
aattttgctgttatcgagttcaac |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43148372 |
aattttgctgttatcgagttcaac |
43148349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 167 - 242
Target Start/End: Complemental strand, 44664805 - 44664730
Alignment:
| Q |
167 |
tggttggagtcgaatcaaagatatcaacaacccacatgtgattgatatcgctaattttgctgttatcgagttcaac |
242 |
Q |
| |
|
||||||||| | |||||| || |||||| | ||||| ||||||| |||||| ||||||||||||| ||||| |||| |
|
|
| T |
44664805 |
tggttggagcccaatcaaggacatcaacgatccacacgtgattgttatcgccaattttgctgttaccgagtacaac |
44664730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University