View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9464_low_9 (Length: 208)
Name: NF9464_low_9
Description: NF9464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9464_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 13 - 179
Target Start/End: Complemental strand, 22396533 - 22396366
Alignment:
| Q |
13 |
tttggtggttactgcagcatattcttgtggttggacataaatgttccctaccaagaacataggagctgtatgtgaatttgaattgttgtgaattattggg |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22396533 |
tttggtggctactgcagcatattcttgtggttggacataaatgttccctaccaagaacataggagctgtatgtgaattagaattgttgtgaattattggg |
22396434 |
T |
|
| Q |
113 |
cttcttcttgtgtgcagacgaaatttctgtccatgtccgaaaattaa-aaaagttagaccataatttt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22396433 |
cttcttcttgtgtgcagacgaaatttctgtccatgtccgaaaattaaaaaaagttagaccataatttt |
22396366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University