View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9465_high_1 (Length: 367)
Name: NF9465_high_1
Description: NF9465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9465_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 28 - 357
Target Start/End: Original strand, 44802582 - 44802911
Alignment:
| Q |
28 |
tcataataaatcaggtatcaaatgttttgcactcgtcggtttcagggttatccttacagtaatcctccaaggggtcagaatccttcttcctatcccttgc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802582 |
tcataataaatcaggtatcaaatgttttgcactcgtcggtttcagggttatccttacagtaatcctccaaggggtcagaatccttcttcctatcccttgc |
44802681 |
T |
 |
| Q |
128 |
atgactcgctgcagcactgagttcctccacttcatcccatgctgctacgcattctccactaactgggtcatcagcacacgtctcttgtgcactctttatg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802682 |
atgactcgctgcagcactgagttcctccacttcatcccatgctgctacgcattctccactaactgggtcatcagcacacgtctcttgtgcactctttatg |
44802781 |
T |
 |
| Q |
228 |
ctctcttctaccttctttgatatctgttctggtgcagcacgaacgggtcgaaccaccgtcatccgacccgatctggctacaccccaccgtgtctgcagtg |
327 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44802782 |
ctctcttcaaccttctttgatatctgttctggtgcagcacgaacgggtcgaaccaccgtcatccgacccgatccggctacaccccaccgtgtctgcagtg |
44802881 |
T |
 |
| Q |
328 |
gtgttgctggtgagatcttgatggtctgtg |
357 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
44802882 |
gtgttgctggtgagatcttgatggtttgtg |
44802911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University