View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9466_high_13 (Length: 237)
Name: NF9466_high_13
Description: NF9466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9466_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 14 - 221
Target Start/End: Original strand, 8556707 - 8556910
Alignment:
| Q |
14 |
aatactggtcttcaacctcaaagcgtcctttatgttcaggtaacttactttctcatctactatttttgtttcttttgtttcaagttgtgtagtagccata |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8556707 |
aatactggtcttcaacctcaaagcgtcctttatgttcaggtaacttactttctcatctactatttttgtttcttttgtttcaagttgcttagtagccata |
8556806 |
T |
|
| Q |
114 |
acctctgcaaccttttatcatctgagctgcacttactggacttctattcaagttatatttatgtatccaatttaaattaggtaaatttagtagtagtacc |
213 |
Q |
| |
|
| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8556807 |
aactctgcaaccttttatcatctgagctgc----actggacttctattcaagttatatttatgtatccaatttaaattaggtaaatttagtagtagtacc |
8556902 |
T |
|
| Q |
214 |
attgtgtt |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
8556903 |
attgtgtt |
8556910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 52
Target Start/End: Original strand, 8552358 - 8552397
Alignment:
| Q |
13 |
taatactggtcttcaacctcaaagcgtcctttatgttcag |
52 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8552358 |
taatactggtcttcaacctcaaagtgtcctttatgttcag |
8552397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University