View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9466_high_9 (Length: 255)

Name: NF9466_high_9
Description: NF9466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9466_high_9
NF9466_high_9
[»] scaffold0050 (1 HSPs)
scaffold0050 (13-254)||(2954-3195)


Alignment Details
Target: scaffold0050 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 13 - 254
Target Start/End: Original strand, 2954 - 3195
Alignment:
13 gaaacataggtcgaatgagaagaatccgagacttttataaagaaaccgtggttaggccataattcagaaccggataatgcaggaacgatgcttatcactt 112  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2954 gaaacataggttgaatgagaagaatccgagacttttataaagaaaccgtggttaggccataattcagaaccggataatgcaggaacgatgcttatcactt 3053  T
113 gcagaagaactgaacggtgttcaccgcgaactttcacattagagttcattgtttggagaagcttcagtagaactccaggtatgagagatgccatcttctt 212  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3054 gaagaagaactgaacggtgttcaccgcgaactttcacattagagttcattgtttggagaagcttcagtagaactccaggtatgagagatgccatcttctt 3153  T
213 ggcgttttgtttaattatatttaaacttttacctgttagatg 254  Q
     |||||||||||||||||||||||||||||||||||||||||    
3154 cgcgttttgtttaattatatttaaacttttacctgttagatg 3195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University