View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9466_low_20 (Length: 269)
Name: NF9466_low_20
Description: NF9466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9466_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 123 - 245
Target Start/End: Original strand, 11199018 - 11199143
Alignment:
| Q |
123 |
tgattataaaaataatattaaactcaac---aacagcattcatgtcaaagcttgtgacatgtctcttcctttgcagaaacatgctttccaatttgcacgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11199018 |
tgattataaaaataatattaaactcaacaacaacagcattcatgtcaaagcttgtgacatgtctcttcctttgcagaaacatgctttccaatttgcacgt |
11199117 |
T |
|
| Q |
220 |
gaccatcttgattctatgcctactaa |
245 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
11199118 |
gaccatcttgattctatgcctactaa |
11199143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 9 - 59
Target Start/End: Original strand, 11198904 - 11198954
Alignment:
| Q |
9 |
agaagcagagaaggagttagagagaaggagcaagtttctaaacagtttgat |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11198904 |
agaagcagagaaggagttagagagaaggagcaagtttctaaacagtttgat |
11198954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University