View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9466_low_22 (Length: 255)
Name: NF9466_low_22
Description: NF9466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9466_low_22 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0050 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 13 - 254
Target Start/End: Original strand, 2954 - 3195
Alignment:
| Q |
13 |
gaaacataggtcgaatgagaagaatccgagacttttataaagaaaccgtggttaggccataattcagaaccggataatgcaggaacgatgcttatcactt |
112 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2954 |
gaaacataggttgaatgagaagaatccgagacttttataaagaaaccgtggttaggccataattcagaaccggataatgcaggaacgatgcttatcactt |
3053 |
T |
 |
| Q |
113 |
gcagaagaactgaacggtgttcaccgcgaactttcacattagagttcattgtttggagaagcttcagtagaactccaggtatgagagatgccatcttctt |
212 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3054 |
gaagaagaactgaacggtgttcaccgcgaactttcacattagagttcattgtttggagaagcttcagtagaactccaggtatgagagatgccatcttctt |
3153 |
T |
 |
| Q |
213 |
ggcgttttgtttaattatatttaaacttttacctgttagatg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3154 |
cgcgttttgtttaattatatttaaacttttacctgttagatg |
3195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University