View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9468_low_24 (Length: 229)
Name: NF9468_low_24
Description: NF9468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9468_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 212
Target Start/End: Complemental strand, 42565509 - 42565310
Alignment:
| Q |
13 |
gagtttcgtgttaatcctattctacatggatttggttacgactgtgttagagatgactataagttgattcgtcatacatgtattgattattgctttccag |
112 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42565509 |
gagtttcgtgctaatcctattctacatggatttggttacgactgtgttagagatgactataagttgattcgtcatacatgtattgattattgctttccag |
42565410 |
T |
 |
| Q |
113 |
acagtagtgatctccttattggcatgccatctgatagagatttatcgttgttgcaagataaatctttaaacccattttgggagatttatagcctaagaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42565409 |
acagtagtgatctccttattggcatgccatctgatagagatttatcgttgttgcaagataaatctttaaacccattttgggagatttatagcctaagaag |
42565310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 75
Target Start/End: Complemental strand, 29352955 - 29352918
Alignment:
| Q |
38 |
atggatttggttacgactgtgttagagatgactataag |
75 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29352955 |
atggatttggttatgactgtgttagagatgactataag |
29352918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 75
Target Start/End: Original strand, 4027478 - 4027516
Alignment:
| Q |
37 |
catggatttggttacgactgtgttagagatgactataag |
75 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
4027478 |
catggatttggttatgaccgtgttagagatgactataag |
4027516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University