View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9468_low_29 (Length: 222)
Name: NF9468_low_29
Description: NF9468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9468_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 38701159 - 38701018
Alignment:
| Q |
48 |
acatttaacattaaaaaatcttcaatttattgttctttaagttcnnnnnnn-cgttctagttccatatatttataacgtttggttggcatgctttattat |
146 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38701159 |
acatttgacattaaaaaatcctcaatttattgttctttaagttcaggaaaaacgttctagttccatatatttatatcgtttggttggcatgctttattat |
38701060 |
T |
 |
| Q |
147 |
atatgatcatgtaatataggagtatttgtctttgtcagcata |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38701059 |
atatgatcatgtaatataggagtatttgtctttgtcagcata |
38701018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University