View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9468_low_31 (Length: 212)
Name: NF9468_low_31
Description: NF9468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9468_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 13 - 196
Target Start/End: Original strand, 39578142 - 39578325
Alignment:
| Q |
13 |
cataggagatccaacagatactcgcacttctggtctcttgaaacgggagcatgtgaaggttcattggtgactgacaggagtagtaggcatgagatgtcga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39578142 |
cataggagatccaacagatactcgcacttctggtctcttgaaacgggagcatgtgaaggttcattggtgactgacaggagtagtaggcatgagatgtcga |
39578241 |
T |
|
| Q |
113 |
ccacaatgatcgacgtctcatcctatatgtagagaaagttgttggtttcgctataccaccactcggcaaagacagataaggagc |
196 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39578242 |
ccacaatgatcgacatctcatcctatatgtagagaaagttgttggtttcgctataccaccactcggcaaagacagataaggagc |
39578325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University