View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9469_high_12 (Length: 247)

Name: NF9469_high_12
Description: NF9469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9469_high_12
NF9469_high_12
[»] chr1 (1 HSPs)
chr1 (1-240)||(36749436-36749675)


Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 36749436 - 36749675
Alignment:
1 ggattacggatgccagaccatccaaatttcctagctagctagtatttaaaaaataacagtctgctgcttgatagagactggtgtgtgaccatgtgcatga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
36749436 ggattacggatgccagaccatccaaatttcctagctagctagtatttaaaaaataacagcctgctgcttgatagagactggtgtgtgaccatgtgcatga 36749535  T
101 gttctttgtttgagattgcaagttatgaactgggagtgggtaacgatagatgtaatggggtactcatattactcactctggtgccaaatatccagtggtc 200  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36749536 gttctttgtttgagattgcaagttatgaaatgggagtgggtaacgatagatgtaatggggtactcatattactcactctggtgccaaatatccagtggtc 36749635  T
201 cccaacacacgggtagaaacctggccatttctcttctctg 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
36749636 cccaacacacgggtagaaacctggccatttctcttctctg 36749675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University