View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9469_low_11 (Length: 395)
Name: NF9469_low_11
Description: NF9469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9469_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 19 - 383
Target Start/End: Complemental strand, 33168871 - 33168508
Alignment:
| Q |
19 |
cccgtgttgtagtaataagaagacggcttctgatgtcgaaggagtggtaagaacatctttgtgaatatcgttccacatcccaaccatttgccaaacttgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33168871 |
cccgtgttgtagtaataagaagacggcttctgatgtcgaagtagtggtaagaacatctttgtgtatatcgttccacatcccaaccatttgccaaacttgt |
33168772 |
T |
|
| Q |
119 |
gtagctaaagggtaatcaaacactacatgtacagggtcttcatgtgcagaatcacaactaaaacaatttgtgcagcactgcatgcctttatcttaaagac |
218 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
33168771 |
gtagccaaagggtaatcaaacactacatgtacagggtcttcatgtgcagaatcacaactaaaacaatttgtacaacactgcatgcctttatcttaaagac |
33168672 |
T |
|
| Q |
219 |
gaactcttgttgacagacaaccgcggcagatacgtcaaactagannnnnnnactttaggtgacactttcaggcatcaaatccccgaccaaaaaccgggtc |
318 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33168671 |
gaactcttgttgacaaacaaccgcggcacatacgtcaaactaga-ttttttactttaggtgacactttcaggcatcaaatccccgaccaaaaaccgggtc |
33168573 |
T |
|
| Q |
319 |
gacgaatatgggatgtgtcaaccaattccttcacacaaagtcagcgaacacttttaaccgagtat |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33168572 |
gacgaatatgggatgtgtcaaccaattccttcacacaaagtcagcgaacacttttaaccgagtat |
33168508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University