View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9469_low_21 (Length: 299)
Name: NF9469_low_21
Description: NF9469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9469_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 15 - 293
Target Start/End: Original strand, 47349222 - 47349501
Alignment:
| Q |
15 |
actttctaggtcaattcaatttacacaaaaatcagttcaaaacaataaacnnnnnnntcgaactgattcagatccaagtcgaatttcatataannnnnnn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47349222 |
actttctaggtcaattcaatttacacaaaaatcagttcaaaacaataaacaaaaaaatcgaactgattcagatccaagtcgaatttcatataattttttt |
47349321 |
T |
|
| Q |
115 |
agctaatcaaactcaagaaccgtgaaaaatctgtaatcaaaagactacactgacagagaaactttctctcatcaaaattcaaccgaatttcagcatgcga |
214 |
Q |
| |
|
|| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47349322 |
agttaatcaaactcaagaaccgtggaaaatctgtaatcaaaagactacactgacagagaaactttctctcatcaaaattcaaccgaatttcagcatgcga |
47349421 |
T |
|
| Q |
215 |
tagagcaattgcaca-taaatttcatccatggcactaaaaatcgcaagaaaacacttcaccatagaaacagtataatcta |
293 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47349422 |
tagagcaattgcacattaaatttcatccatagcactaaaaatcgcaagaaaacacttcaccatagaaacagtaaaatcta |
47349501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University