View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9469_low_23 (Length: 274)
Name: NF9469_low_23
Description: NF9469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9469_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 267
Target Start/End: Complemental strand, 2946037 - 2945788
Alignment:
| Q |
18 |
agttaatctaaaacattgtactttctaagagataactaactgcattgaattggaactttctctactcagccccaggatcatataccaaaacttgtttgtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2946037 |
agttaatctaaaacattgtactttctaagagataactaactgcattgaattggaactttctctactcagccccaggatcatataccaaaacttgtttgtg |
2945938 |
T |
|
| Q |
118 |
ttttccataatttgcatgccttatcttatcatgcctcagatctttgatcagtcctgtagaagggtcctgttcctttctgtgtttgtgatgtgcaggatgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2945937 |
ttttccataatttgcatgccttatcttatcatgcctcagatctttgatcagtcctgtagaagggtcctgttcctttctgtgtttgtgatgtgcaggatgg |
2945838 |
T |
|
| Q |
218 |
ttatcatcaatattttgcaaattatccacatgttttttatgtctctgctt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
2945837 |
ttatcatcaatattttgcaaattatccacatgttttctatgtctatgctt |
2945788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University