View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9469_low_30 (Length: 247)
Name: NF9469_low_30
Description: NF9469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9469_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 36749436 - 36749675
Alignment:
| Q |
1 |
ggattacggatgccagaccatccaaatttcctagctagctagtatttaaaaaataacagtctgctgcttgatagagactggtgtgtgaccatgtgcatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36749436 |
ggattacggatgccagaccatccaaatttcctagctagctagtatttaaaaaataacagcctgctgcttgatagagactggtgtgtgaccatgtgcatga |
36749535 |
T |
|
| Q |
101 |
gttctttgtttgagattgcaagttatgaactgggagtgggtaacgatagatgtaatggggtactcatattactcactctggtgccaaatatccagtggtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36749536 |
gttctttgtttgagattgcaagttatgaaatgggagtgggtaacgatagatgtaatggggtactcatattactcactctggtgccaaatatccagtggtc |
36749635 |
T |
|
| Q |
201 |
cccaacacacgggtagaaacctggccatttctcttctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36749636 |
cccaacacacgggtagaaacctggccatttctcttctctg |
36749675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University