View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9469_low_35 (Length: 229)
Name: NF9469_low_35
Description: NF9469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9469_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 7 - 186
Target Start/End: Complemental strand, 41087993 - 41087813
Alignment:
| Q |
7 |
agaggttcatttctcctaagaactaaaaggttaacatcaataaataaattgtgtttccatgtaagataa-ggagtttattgagttgcaaccaactttgtt |
105 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41087993 |
agaggttcatttctcctaagaactaaatggttaacatcaataaataaattgtgtttccatgtaagataaaggagtttattgagttgcaaccaactttgtt |
41087894 |
T |
|
| Q |
106 |
tacacatcacatttgttgttcatcaatgacaatcaccaacaatatgtgataatttagggtttgaaagtgactatgttgtat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41087893 |
tacacatcacatttgttgttcatcaatgacaatcaccaacaatatgtgataatttaggatttgaaagtgactatgttgtat |
41087813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University