View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9469_low_36 (Length: 222)
Name: NF9469_low_36
Description: NF9469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9469_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 9 - 163
Target Start/End: Original strand, 27208287 - 27208441
Alignment:
| Q |
9 |
agtttggtgtttgaaagtgattgatgaagtttctctcttcttcttgacatatatatatagccttctacatatacaaattattggcttaattataatattg |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27208287 |
agtttgctgtttgaaagtgattgatgaagtttctctcttcttcttgacatatatatatagccttctacatatacaaattattggcttaattataatattg |
27208386 |
T |
|
| Q |
109 |
ctaccctatttacatccgttcaagaaattggtttctaattttaaaatcactgtgg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27208387 |
ctaccctatttacatccgttcaagaaattggtttctaattttcaaatcactgtgg |
27208441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 9 - 74
Target Start/End: Complemental strand, 27443231 - 27443166
Alignment:
| Q |
9 |
agtttggtgtttgaaagtgattgatgaagtttctctcttcttcttgacatatatatatagccttct |
74 |
Q |
| |
|
|||||| |||||||| ||||||||||||||| ||||| |||| ||||||| |||||||||||||| |
|
|
| T |
27443231 |
agtttgctgtttgaaggtgattgatgaagttgttctctgcttcatgacataaatatatagccttct |
27443166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 65
Target Start/End: Original strand, 27221612 - 27221668
Alignment:
| Q |
9 |
agtttggtgtttgaaagtgattgatgaagtttctctcttcttcttgacatatatata |
65 |
Q |
| |
|
|||||| |||||| ||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
27221612 |
agtttgctgtttgtaagtgattgatgaagttgttctctgcttcgtgacatatatata |
27221668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 65
Target Start/End: Original strand, 27433409 - 27433449
Alignment:
| Q |
25 |
gtgattgatgaagtttctctcttcttcttgacatatatata |
65 |
Q |
| |
|
|||||||||||| || |||||| |||||||||||||||||| |
|
|
| T |
27433409 |
gtgattgatgaaattgctctctgcttcttgacatatatata |
27433449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University