View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9469_low_37 (Length: 222)
Name: NF9469_low_37
Description: NF9469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9469_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 40 - 144
Target Start/End: Original strand, 2928489 - 2928593
Alignment:
| Q |
40 |
caactagtctgtcaatctctggtgtactgtttcggcagtttttcagtttcttagatttgtgtattggagctgttctattgcgtttttcgtagtataagtt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||| ||| |
|
|
| T |
2928489 |
caactagtctgtcaatctctggtgtactgtttgggcggtttttcagtttcttagatttgtgtattggagttgttctattttgtttttcttagtatcagtc |
2928588 |
T |
 |
| Q |
140 |
agttg |
144 |
Q |
| |
|
||||| |
|
|
| T |
2928589 |
agttg |
2928593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 86 - 142
Target Start/End: Complemental strand, 3002773 - 3002717
Alignment:
| Q |
86 |
tttcttagatttgtgtattggagctgttctattgcgtttttcgtagtataagttagt |
142 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
3002773 |
tttcttatatttgtgtattggagctgttctattgcgtttttcttagtatcagttagt |
3002717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 79 - 119
Target Start/End: Complemental strand, 37200292 - 37200252
Alignment:
| Q |
79 |
ttttcagtttcttagatttgtgtattggagctgttctattg |
119 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
37200292 |
ttttcagtttcttagttttgtgtattggggctgctctattg |
37200252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University