View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9470_high_8 (Length: 252)
Name: NF9470_high_8
Description: NF9470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9470_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 4 - 218
Target Start/End: Original strand, 25999026 - 25999240
Alignment:
| Q |
4 |
ctgtttgtagcaaacagttctcattgacttgttaaaactattctttcaaatttatgcttaaatgtttgcaatcaaaatcaactaaacagaaattggaatg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25999026 |
ctgtttgtagcaaacagttctcattgacttgttaaaactattctttcaaatttatgcttaaatgtttgcaatcaaaatcaactaaacagaaattggaatg |
25999125 |
T |
 |
| Q |
104 |
gtttctgcagtttttatgaggagtgtaaccttgcaaatgataaaaatcactctgtccactatttctcattaatgctttatcttcctgtttattttacaga |
203 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25999126 |
gtttctacaatttttatgaggagtgtaaccttgcaaatgataaaaatcactctgtccactttttcttattaatgctttatcttcctgtttattttacaga |
25999225 |
T |
 |
| Q |
204 |
ttcatctgcctataa |
218 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
25999226 |
ttcacctgcctataa |
25999240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University