View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9470_low_22 (Length: 240)
Name: NF9470_low_22
Description: NF9470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9470_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 26592584 - 26592720
Alignment:
| Q |
1 |
catttggaaaatttgatatacattgtgattaataacattatttcaaagcaaattggtatatttcttgaaatccaaagataattacatacagaagcttaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26592584 |
catttggaaaatttgatatacattgtgattaataacattatttcaaagcaaattggtatatttcttgaaatccaaagatcattacatacagaagcttaat |
26592683 |
T |
 |
| Q |
101 |
caccattgctttgatatctgataactgtctcttgaga |
137 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26592684 |
caccattgctttgatttctgataactgtctcttgaga |
26592720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University